0

856 parallel to serial conversion using a parallel in shift register

Báo cáo khoa học:

Báo cáo khoa học: "Better Automatic Treebank Conversion Using A Feature-Based Approach" doc

Báo cáo khoa học

... the training phase, each target-style parse tree in the training data is transformed into a binary tree (Charniak et al., 1998) and then decomposed into a (golden) action-state sequence A classifier ... Automatic Adaptation of Annotation Standards: Chinese Word Segmentation and POS Tagging - A Case Study In Proceedings of ACL 2009, pages 522-530 Wenbin Jiang and Qun Liu 2009 Automatic Adaptation ... Klein 2006 Learning Accurate, Compact, and Interpretable Tree Annotation In Proceedings of ACL 2006, pages 433-440 Slav Petrov, Pi-Chuan Chang, Michael Ringgaard, and Hiyan Alshawi 2010 Uptraining...
  • 5
  • 328
  • 0
báo cáo hóa học:

báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

Toán học

... synthase (Ptgs2) Reverse TGTACAGAGCTCCACGGCTG CiiTA Forward GCATGTTGCACACCAGCTCCCT Reverse ACGCCAGTCTGACGAAGGTCCA COX-2 Forward CAGACAACATAAACTGCGCCTT Reverse GATACACCTCTCCACCAATGACC IL- 1a Forward ... Reverse AAGTGCATCATCGTTGTTCATACA IL-12 P35 Forward GCATGCTGGTGGCCATCGATGA Reverse GCGTGAAGCAGGATGCAGAGCT IL-12/23 P40 Forward TGTGCTCGTGGCCTGATCCACT Reverse CGCAGCCCTGATTGAAGAGCTGT TNF -a Reverse GCAGGGGCTCTTGACGGCAG ... Forward TACTCGTCGGGAGGAGACGACTCT 107 bp NM_010554.4 interleukin alpha Reverse TCCTTCAGCAACACGGGCTGGT IL-1b Forward CCTTCCAGGATGAGGACATGA Reverse TGAGTCACAGAGGATGGGCTC 71 bp NM_008361.3 interleukin...
  • 8
  • 447
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Research Article Design of a Versatile and Low Cost μVolt Level A to D Conversion System for Use in Medical Instrumentation Applicatio" pdf

Hóa học - Dầu khí

... phenomena, thus it is only necessary to include an appropriate calibration factor in order to provide automatic interpretation of the output pulse train and to offer a direct readout in the numerical ... coaxial cable for remote connection to a PC or data logger where further analysis and storage of measurement data can occur The change in output frequency bears a linear relationship to the magnitude ... added in this instance to provide a conventional sample and hold facility which, in the case of a hand-held instrument, allows for a “snapshot” of the data stream to be made manually at a time chosen...
  • 6
  • 391
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Analog-to-Digital Conversion Using Single-Layer Integrate-and-Fire Networks with Inhibitory Connections" potx

Báo cáo khoa học

... relatively large compared to the signal bandwidth In general, 1-bit Σ − ∆ modulators are operated at sampling rates that are at least a factor of a hundred larger than the signal bandwidth for audio ... increasing the maximum sampling rate Conventional 1-bit A/ D converters operate at sampling rates of up to 100 MHz If we are able to coordinate multiple converters using feedback in an integrate-and-fire ... and electronic A/ D converters Sensory organs are basically translating continuous analog input into a digital representation of that information The primary difference being that all biological...
  • 10
  • 333
  • 0
Báo cáo y học:

Báo cáo y học: "Teaching child and adolescent psychiatry to undergraduate medical students - A survey in German-speaking countries"

Y học thưởng thức

... faculty members at each medical school focusing on a separate area: “examination and standards in examination,” “e-learning in medicine,” “evaluation of teaching,” “practical year,” and “preparation ... CAP in the German-speaking parts of Europe: 26 in Germany, in Austria, and in Switzerland After mailings and some personal reminders, the response rate was 100% Further information was obtained ... necessary decisions • know and be able to apply legal regulations • be able to establish contact with a patient in an appropriate and empathic manner and have examined, under supervision, at least...
  • 8
  • 538
  • 0
Car smart - A pocket guide to buying and owning a car in Queensland pdf

Car smart - A pocket guide to buying and owning a car in Queensland pdf

Kĩ thuật Viễn thông

... buying, repairing and maintaining a car in Queensland You can find full information at www.fairtrading.qld.gov.au There are other fair trading smart guides too: • Buy smart A pocket guide to ... plate indicates the date the car met certain Australian safety standards, making it legal to drive This date is not necessarily the same as the manufacture date of the car and it does not indicate ... making a commitment to a repairer, check the terms of payment If you are unable to pay and haven’t come to any financial arrangement, the repairer is allowed to keep your car until you pay Authorise...
  • 28
  • 357
  • 0
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt

Báo cáo khoa học

... nuclear extracts were incubated with avidin–agarose beads (Sigma) at °C for 30 to eliminate materials in the extracts that bind nonspecifically to the beads After removing the beads by filtration, ... of reaction mixture using the RT-PCR kit (Stratagene) PCR amplification was performed using LA Taq (Takara, Japan) in a total volume of 50 lL containing 55 pg of competitor At this concentration, ... 30 at 25 °C After elinimating by centrifugation denatured proteins generated during the binding reaction, the mixture was combined with 20 lL avidin–agarose beads and incubated at room temperature...
  • 11
  • 628
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article Removing the Influence of Shimmer in the Calculation of Harmonics-To-Noise Ratios Using Ensemble-Averages in Voice Signals" docx

Hóa học - Dầu khí

... avoid values near to zero in the denominator of HNRYum in (4) The average value for 100 realizations of the random variables involved (noise and shimmer) was found for each HNR estimation variant ... hoarseness,” Journal of the Acoustical Society of America, vol 71, pp 1544–1550, 1982 [10] H Kasuya, S Ogawa, K Mashima, and S Ebihara, “Normalized noise energy as an acoustic measure to evaluate ... not applicable to vocal tract filtered signals Functional Data Analysis (FDA) has also been used to perform the optimal time alignment of pulses prior to averaging [15] Shimmer corrections to ensemble...
  • 7
  • 243
  • 0
McGraw.Hill PIC Robotics A Beginners Guide to Robotics Projects Using the PIC Micro eBook-LiB Part 8 ppt

McGraw.Hill PIC Robotics A Beginners Guide to Robotics Projects Using the PIC Micro eBook-LiB Part 8 ppt

Kĩ thuật Viễn thông

... motor  shaft, and  collapse  the  tubing  onto  the  shaft, using pliers There  is  a small cutaway on the gearbox motor shaft (see Fig 9.10) If you can collapse the tubing into this cutaway, you will create a strong fit between the shaft and ... Since the resistance values of the CdS cells can vary so greatly, it’s a good idea to buy a few more than you need and measure the resistances to find a pair whose resistances are close There are a few ways you can measure the ... The CdS photoresistors typically have large variances in resistance between cells It is useful to use a pair of CdS cells for this robot that matches, as best as one can match them, in resistance Since the resistance values of the CdS cells can vary so greatly,...
  • 20
  • 308
  • 0
AN1184   using a timer to interface 8051 MCUs with UNIO® bus compatible serial EEPROMs

AN1184 using a timer to interface 8051 MCUs with UNIO® bus compatible serial EEPROMs

Cao đẳng - Đại học

... Bytes Back After the Read command and word address have been sent and acknowledged, the serial EEPROM starts to send the data from the array starting at the address specified To read a single ... Technology Inc AN1184 Figure 10 shows the MCU reading two bytes of data The MCU sends a NoMAK after the second byte to indicate that no more data is requested and to terminate the command Reading Data ... that are [integer multiples of the page size] minus Attempts to write across a page boundary result in the data being wrapped back to the beginning of the current page, thus overwriting any data...
  • 16
  • 279
  • 0
AN1187   using a timer to interface PIC18 MCUs with UNIO® bus compatible serial EEPROMs

AN1187 using a timer to interface PIC18 MCUs with UNIO® bus compatible serial EEPROMs

Cao đẳng - Đại học

... continues to request data At the end of the array, the internal word address is automatically reset back to 0x000 A NoMAK terminates the operation Reading Data Back After the read command and ... Technology Inc 0 0 0 0 DS01187B-page AN1187 PAGE READ Command and Word Address for Read The serial EEPROM allows data to be read from the array in a random access manner Reading data from the array is ... terminates the command by generating a NoMAK in place of the MAK, and the serial EEPROM again responds with a SAK This also initiates the internal write cycle (TWC) Data Bytes Once the word address...
  • 14
  • 450
  • 0
AN1197   using a hardware module to interface 8051 MCUs with SPI serial EEPROMs

AN1197 using a hardware module to interface 8051 MCUs with SPI serial EEPROMs

Cao đẳng - Đại học

... read/write) using internal hardware parts and a main routine The main routine writes a string in the SPI serial EEPROM, reads it back and compares the two strings, displaying the results on LEDs on an ... Technology Inc AN1197 PAGE WRITE addresses that are [integer multiples of the page size] minus Attempts to write across a page boundary result in the data being wrapped back to the beginning of ... size), and they end at addresses that are integer multiples of [page size-1] If a Page Write command attempts to write across a physical page boundary, the result is that the data wraps around to...
  • 14
  • 298
  • 0
Using Cooperative Learning to Integrate Thinking and Information Technology in a Content.doc

Using Cooperative Learning to Integrate Thinking and Information Technology in a Content.doc

Tư liệu khác

... on teachers for information, and instead can work together to find and share knowledge All the same benefits of cooperative learning presented above in the normal classroom apply equally in information ... pause in computer use, students can analyze what they have learned and done, share information with others, and plan their next steps After using computers, students can again analyze and share ... relations Thinking skills Self-esteem Enjoyment Cooperative Learning and Thinking and Creativity Cooperative learning is believed to promote thinking and creativity in many ways (Hythecker, Dansereau,...
  • 9
  • 668
  • 0
Using a DataGrid Control to Access a Database

Using a DataGrid Control to Access a Database

Kỹ thuật lập trình

... Preview dialog box Next, you need to create a DataSet object You use a DataSet object to a store local copy of the information stored in the database A DataSet object can represent database structures ... Northwind database; you might need to get the password from your database administrator) Drill down to the Customers table in the Northwind database and drag it to your form This creates a SqlConnection ... contains DataSet1, as shown in Figure 6.15 Figure 6.15: Entering the DataSet details in the Generate Dataset dialog box Click the OK button to continue This adds a new DataSet object named dataSet11...
  • 8
  • 486
  • 0
Using a SqlConnection Object to Connect to a SQL Server Database phần 1

Using a SqlConnection Object to Connect to a SQL Server Database phần 1

Kỹ thuật lập trình

... Server database */ using System; using System.Data; using System.Data.SqlClient; class MySqlConnection { public static void Main() { // formulate a string containing the details of the // database ... ADO.NET automatically stores database connections in a pool Connection pooling offers a great performance improvement because you don't have to wait for a brand new connection to the database to be ... timeout to Before starting a Windows session, you typically log in to Windows with a username and password If you're using Windows integrated security, you can pass your username and password to SQL...
  • 7
  • 729
  • 0
Tài liệu Using a SqlConnection Object to Connect to a SQL Server Database phần 2 doc

Tài liệu Using a SqlConnection Object to Connect to a SQL Server Database phần 2 doc

Kỹ thuật lập trình

... using System; using System.Data; using System.Data.SqlClient; class InfoMessage { // define the InfoMessageHandler() method to handle the // InfoMessage event public static void InfoMessageHandler( ... SqlConnection("server=localhost;database=Northwind;uid=sa;pwd=sa"); // monitor the StateChange event using the StateChangeHandler() method mySqlConnection.StateChange += new StateChangeEventHandler(StateChangeHandler); ... SqlConnection("server=localhost;database=Northwind;uid=sa;pwd=sa"); // monitor the InfoMessage event using the InfoMessageHandler() method mySqlConnection.InfoMessage += new SqlInfoMessageEventHandler(InfoMessageHandler);...
  • 7
  • 592
  • 0
Tài liệu Using a DataView to Control Edits, Deletions, or Additions in Windows Forms pdf

Tài liệu Using a DataView to Control Edits, Deletions, or Additions in Windows Forms pdf

Quản trị mạng

... adding, editing, or deleting the data in the control Binding a DataGrid to a DataTable binds to the default view of the underlying DataTable The DataView class represents a view of the DataTable ... SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable dtOrders = new DataTable("Orders"); da.FillSchema(dtOrders, SchemaType.Source); ... or sets a Boolean value indicating whether deletes are allowed AllowEdit Gets or sets a Boolean value indicating whether edits are allowed AllowNew Gets or sets a Boolean value indicating whether...
  • 3
  • 532
  • 0
Tài liệu Using a Single Stored Procedure to Update Multiple Changes to a SQL Server Database pdf

Tài liệu Using a Single Stored Procedure to Update Multiple Changes to a SQL Server Database pdf

Kỹ thuật lập trình

... Namespaces, variables, and constants using System; using System.Configuration; using System.Windows.Forms; using System.Text; using System.IO; using System.Data; using System.Data.SqlClient; private ... System.EventArgs e) { ds = new DataSet( ); // Create the DataAdapter SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME, ConfigurationSettings.AppSettings["Sql_ConnectString"]); // Load ... schema and data for the table da.FillSchema(ds, SchemaType.Source, TABLENAME); da.Fill(ds, TABLENAME); // Columns in XML representation of data as attributes foreach(DataColumn col in ds.Tables[TABLENAME].Columns)...
  • 7
  • 442
  • 0
Tài liệu Using XSD Schema Files to Load and Save a DataSet Structure pptx

Tài liệu Using XSD Schema Files to Load and Save a DataSet Structure pptx

Kỹ thuật lập trình

... System.EventArgs e) { DataSet ds = new DataSet( ); SqlDataAdapter da; // Fill the Order table and add it to the DataSet da = new SqlDataAdapter("SELECT * FROM Orders", ConfigurationSettings.AppSettings["Sql_ConnectString"]); ... it to the DataSet da = new SqlDataAdapter("SELECT * FROM [Order Details]", ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderDetailTable = new DataTable(ORDERDETAILS_TABLE); ... ConfigurationSettings.AppSettings["Sql_ConnectString"]); DataTable orderTable = new DataTable(ORDERS_TABLE); da.FillSchema(orderTable, SchemaType.Source); da.Fill(orderTable); ds.Tables.Add(orderTable); // Fill the OrderDetails table and add...
  • 8
  • 403
  • 0
Tài liệu Do Firms Want to Borrow More? Testing Credit Constraints Using a Directed Lending Program doc

Tài liệu Do Firms Want to Borrow More? Testing Credit Constraints Using a Directed Lending Program doc

Ngân hàng - Tín dụng

... regression in the sample where we observe a change in loans 25 constrained and access to market capital increases very fast as a function of access to bank capital, to the point where total capital stock ... help in understanding the Indian banking industry, Sankarnaranayan for his work collecting the data, Dean Yang and Niki Klonaris for excellent research assistance, and Robert Barro, Sugato Battacharya, ... 35 Defaults are also quite common, at least in India Working capital loans in India are not nearly as safe as they are supposed to be (and actually are, at least in the U.S.).This is because the...
  • 53
  • 350
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008